Skip Nav Destination
Close Modal
Update search
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
Filter
- Title
- Author
- Author Affiliations
- Full Text
- Abstract
- Keyword
- DOI
- ISSN
- EISSN
- Issue
- Volume
- References
NARROW
Format
Subjects
Article Type
Date
Availability
1-50 of 63
Keywords: mitochondria
Close
Follow your search
Access your saved searches in your account
Would you like to receive an alert when new items match your search?
1
Sort by
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2023) 137 (9): 707–725.
Published: 05 May 2023
... of University College London in an all-inclusive Read & Publish agreement with Portland Press and the Biochemical Society under a transformative agreement with JISC. hormones immune response mitochondria organ dysfunction sepsis stress response Sepsis is defined as a dysregulated host...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2023) 137 (6): 415–434.
Published: 21 March 2023
... with Portland Press and the Biochemical Society under a transformative agreement with Individual. autophagy estrogen Insulin metabolic disease metabolism mitochondria Since the definition of hormone by the British physiologist Ernest Starling in 1905 [ 1 ], hormone research has advanced...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2023) 137 (5): 353.
Published: 01 March 2023
... © 2023 The Author(s). 2023 This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY) . biomarker cell-free DNA cGAS-STING DNA damage mitochondria...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2023) 137 (3): 219–237.
Published: 02 February 2023
... that mitochondria, the central players in cellular iron utilisation, are dysfunctional in respiratory cells in individuals with COPD, with alterations in mitochondrial bioenergetics and dynamics driving disease progression. Understanding the molecular mechanisms underlying the dysfunction of mitochondria...
Articles
Keitaro Ueda, Chiemi Sakai, Takafumi Ishida, Kosuke Morita, Yusuke Kobayashi, Yasunori Horikoshi, Akiko Baba, Yuma Okazaki, Masao Yoshizumi, Satoshi Tashiro, Mari Ishida
Journal:
Clinical Science
Clin Sci (Lond) (2023) 137 (2): 163–180.
Published: 24 January 2023
... level of cell-free DNA (cfDNA), a result of mitochondrial and/or genomic DNA damage, as a biomarker for atherosclerosis. Cigarette smoke extract (CSE) increased DNA damage in the nucleus and mitochondria in human endothelial cells. Mitochondrial damage induced minority mitochondrial outer membrane...
Includes: Supplementary data
Articles
Structural functionality of skeletal muscle mitochondria and its correlation with metabolic diseases
Journal:
Clinical Science
Clin Sci (Lond) (2022) 136 (24): 1851–1871.
Published: 22 December 2022
... a high level of metabolic flexibility, which is reduced in several metabolic diseases, including obesity and Type 2 diabetes (T2D). Skeletal muscle health is highly dependent on optimally functioning mitochondria that exist in a highly integrated network with the sarcoplasmic reticulum and sarcolemma...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2022) 136 (14): 1081–1110.
Published: 27 July 2022
... disorders metabolic regulation mitochondria oxidative phosphorylation skeletal muscle According to the World Health Organization, more than 1 billion adults are overweight and an additional 650 million adults are living with obesity. The global prevalence of obesity has tripled since the 1970s...
Articles
Chayodom Maneechote, Thawatchai Khuanjing, Benjamin Ongnok, Apiwan Arinno, Nanthip Prathumsap, Titikorn Chunchai, Busarin Arunsak, Wichwara Nawara, Siriporn C. Chattipakorn, Nipon Chattipakorn
Journal:
Clinical Science
Clin Sci (Lond) (2022) 136 (11): 841–860.
Published: 01 June 2022
... investigated whether treatment with Mdivi-1 and M1 protects the heart against DOX-induced cardiotoxicity via mitochondria-targeted pathways. Male Wistar rats ( n =40) received DOX (3 mg/kg, six doses, n =32) or 3% dimethylsulfoxide (DMSO) in the normal saline solution (NSS) ( n =8) as a control. DOX-injected...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2022) 136 (5): 345–360.
Published: 09 March 2022
... progression towards end-stage renal disease (ESRD). Renal tubular cells are populated with a high number of mitochondria, which produce cellular energy and modulate several important cellular processes, including generation of reactive oxygen species (ROS), calcium homeostasis, proliferation, and apoptosis...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2021) 135 (4): 593–595.
Published: 18 February 2021
...Shaimaa Nasr Amin This commentary highlights the research entitled: Transplantation of platelet-derived mitochondria alleviates cognitive impairment and mitochondrial dysfunction in db/db mice, presented by Ma et al. appearing in Clinical Science (2020) 134 (16), https://doi.org/10.1042/CS20200530...
Articles
Miao Chen, Caoyu Ji, Qingchen Yang, Shuya Gao, Yue Peng, Zhe Li, Xingyu Gao, Yaoting Li, Nan Jiang, Yubin Zhang, Xiaohong Bian, Caiping Chen, Kaidi Zhang, Daniel Sanchis, Fangrong Yan, Junmei Ye
Journal:
Clinical Science
Clin Sci (Lond) (2020) 134 (17): 2381–2398.
Published: 16 September 2020
... mitochondria morphology in WT and AKT2 KO soleus muscle ( n =3 per genotype). ( B,C ) Quantification of mitochondrial copies in the skeletal muscle of WT and AKT2 KO mice at the age of 3 (WT, n =7; AKT2 KO, n =5) and 8 months (WT, n =10; AKT2 KO, n =6). The abundance of mtDNA was measured by real...
Includes: Supplementary data
Articles
Runa S.J. Lindblom, Gavin C. Higgins, Tuong-Vi Nguyen, Maryann Arnstein, Darren C. Henstridge, Cesare Granata, Matthew Snelson, Vicki Thallas-Bonke, Mark E. Cooper, Josephine M. Forbes, Melinda T. Coughlan
Journal:
Clinical Science
Clin Sci (Lond) (2020) 134 (2): 239–259.
Published: 29 January 2020
...; and ‡ the db/db mice treated with Alisporivir. Abbreviations: T1DM, Type 1 diabetes; T2DM, Type 2 diabetes. Figure 6 Db/db mice exhibit changes in mitochondrial function with minor modulation by Alisporivir ( A ) Citrate synthase activity in isolated renal cortex mitochondria mean ± SD; ( B...
Includes: Supplementary data
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2019) 133 (22): 2245–2264.
Published: 19 November 2019
... importance. In turn, the liver houses a very high number of mitochondria, crucial metabolic unifiers of both extrinsic and intrinsic signals that converge in apoptosis activation. The role of lifestyle options is also dissected, highlighting the management of modifiable risk factors, such as obesity...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2019) 133 (17): 1871–1881.
Published: 10 September 2019
... process. For instance, both miR-194 and miR-29a could modulate cardiac mitochondrial biogenesis and activities in vitro and in vivo [ 11 , 12 ]. Besides, miR-122 determined the metabolic gene profiles of hepatic mitochondria in hepatocellular carcinoma [ 13 ]. Therefore, miR-122 might be a potential...
Includes: Supplementary data
Articles
Yujia Yuan, Younan Chen, Tianqing Peng, Lan Li, Wuzheng Zhu, Fei Liu, Shuyun Liu, Xingxing An, Ruixi Luo, Jingqiu Cheng, Jingping Liu, Yanrong Lu
Journal:
Clinical Science
Clin Sci (Lond) (2019) 133 (15): 1759–1777.
Published: 14 August 2019
... GTGGTACGACCAGAGGCATAC SDHD-F TGTCACCAAGCCACCACTC SDHD-R CCACAGAGCAGGGATTCAAG Figure 11 Schematic representation of the regulatory role of mitochondria and autophagy–lysosome system in macrophages Under normal physiological conditions, damaged mitochondria was recognized and degradation...
Includes: Supplementary data
Articles
Gargi Mahapatra, S. Carrie Smith, Timothy M. Hughes, Benjamin Wagner, Joseph A. Maldjian, Barry I. Freedman, Anthony J. A. Molina
Journal:
Clinical Science
Clin Sci (Lond) (2018) 132 (23): 2509–2518.
Published: 05 December 2018
... bioenergetics diabetes mitochondria neuroimaging Type 2 diabetes mellitus (T2DM) is one of the most common diseases in older adults [ 1 ]. Those with T2DM are susceptible to diseases like neuropathy, retinopathy, nephropathy, stroke, and ischemic heart disease, and are more likely to suffer from...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2018) 132 (20): 2163–2167.
Published: 19 October 2018
... of the study, potential molecular mechanisms of mitochondrial fission, consequences of the fission, and future research directions. cardiomyocytes ischaemia-reperfusion injury mitochondria Correspondence: Satoru Eguchi ( seguchi@temple.edu ) 21 08 2018 13 09 2018 24 09 2018...
Articles
Ming Zhan, Irtaza Usman, Jingbo Yu, Liemin Ruan, Xueyan Bian, Jun Yang, Shikun Yang, Lin Sun, Yashpal S. Kanwar
Journal:
Clinical Science
Clin Sci (Lond) (2018) 132 (12): 1297–1314.
Published: 26 June 2018
... dynamics were investigated by confocal microscopy of HK2 cells (human proximal tubular cell lines) stained with Mitotracker red or green dye along with Western blotting of the relevant proteins that modulate mitochondrial dynamics. Filamentous morphologic characteristic of mitochondria was readily...
Includes: Supplementary data
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2017) 131 (16): 2063–2078.
Published: 24 July 2017
...Xiaoqiang Tang; Xiao-Feng Chen; Hou-Zao Chen; De-Pei Liu Mitochondria are heterogeneous and essentially contribute to cellular functions and tissue homeostasis. Mitochondrial dysfunction compromises overall cell functioning, tissue damage, and diseases. The advances in mitochondrion biology...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2017) 131 (15): 1919–1922.
Published: 07 July 2017
...Gareth A. Nye; Giorgos K. Sakellariou; Hans Degens; Adam P. Lightfoot Mitochondria are no longer solely regarded as the cellular powerhouse; instead, they are now implicated in mediating a wide-range of cellular processes, in the context of health and disease. A recent article in Clinical Science...
Articles
Renée Ventura-Clapier, Maryline Moulin, Jérôme Piquereau, Christophe Lemaire, Mathias Mericskay, Vladimir Veksler, Anne Garnier
Journal:
Clinical Science
Clin Sci (Lond) (2017) 131 (9): 803–822.
Published: 19 April 2017
...Renée Ventura-Clapier; Maryline Moulin; Jérôme Piquereau; Christophe Lemaire; Mathias Mericskay; Vladimir Veksler; Anne Garnier It is increasingly acknowledged that a sex and gender specificity affects the occurrence, development, and consequence of a plethora of pathologies. Mitochondria...
Articles
Jerome Morel, Iain Hargreaves, David Brealey, Viruna Neergheen, Janne T. Backman, Sandro Lindig, Marcus Bläss, Michael Bauer, Daniel F. McAuley, Mervyn Singer
Journal:
Clinical Science
Clin Sci (Lond) (2017) 131 (8): 747–758.
Published: 06 April 2017
..., reflecting experiences in patient studies. Correspondence: Mervyn Singer ( m.singer@ucl.ac.uk ) 9 11 2016 2 2 2017 15 2 2017 15 2 2017 © 2017 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society 2017 mitochondria organ dysfunction...
Includes: Supplementary data
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2017) 131 (1): 1–2.
Published: 21 November 2016
... organelles. Here, endothelial cell dysfunction induced by T-lymphocyte derived microparticles activated a signalling cascade which involved temporal cross-talk between the ER and the mitochondria leading to loss of bioavailable nitric oxide and impaired vasoregulation [ 14 ]. This study offers new...
Articles
Marie-Claude Denis, Denis Roy, Pantea Rahmani Yeganeh, Yves Desjardins, Thibault Varin, Nour Haddad, Devendra Amre, Alain Théophile Sané, Carole Garofalo, Alexandra Furtos, Natalie Patey, Edgard Delvin, Eric Tremblay, André Marette, Jean-François Beaulieu, Emile Levy
Journal:
Clinical Science
Clin Sci (Lond) (2016) 130 (23): 2217–2237.
Published: 31 October 2016
...). published by Portland Press Limited on behalf of the Biochemical Society 2016 inflammation mitochondria peroxidation polyphenol • Apple peel polyphenols represent an efficient functional food for the prevention and treatment of inflammatory bowel diseases. • Apple peel polyphenols...
Includes: Supplementary data
Articles
Marc Catalán-García, Glòria Garrabou, Constanza Morén, Mariona Guitart-Mampel, Adriana Hernando, Àngels Díaz-Ramos, Ingrid González-Casacuberta, Diana-Luz Juárez, Maria Bañó, Jennifer Enrich-Bengoa, Sonia Emperador, José César Milisenda, Pedro Moreno, Ester Tobías, Antonio Zorzano, Julio Montoya, Francesc Cardellach, Josep Maria Grau
Journal:
Clinical Science
Clin Sci (Lond) (2016) 130 (19): 1741–1751.
Published: 31 August 2016
...@clinic.ub.es ). 3 2 2016 5 7 2016 13 7 2016 13 7 2016 © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society 2016 In this study, we describe the role of mitochondria in sIBM, demonstrating that deregulated mitochondrial dynamics...
Includes: Supplementary data
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2016) 130 (14): 1179–1184.
Published: 01 June 2016
...Cathal Michael McCarthy; Louise Clare Kenny Mitochondria are extensively identified for their bioenergetic capacities; however, recently these metabolic hubs are increasingly being appreciated as critical regulators of numerous cellular signalling systems. Mitochondrial reactive oxygen species have...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2016) 130 (11): 843–852.
Published: 22 April 2016
...Dennis Dahlmans; Alexandre Houzelle; Patrick Schrauwen; Joris Hoeks The western dietary habits and sedentary lifestyle largely contributes to the growing epidemic of obesity. Mitochondria are at the front line of cellular energy homoeostasis and are implicated in the pathophysiology of obesity...
Articles
Melinda T. Coughlan, Tuong-Vi Nguyen, Sally A. Penfold, Gavin C. Higgins, Vicki Thallas-Bonke, Sih Min Tan, Nicole J. Van Bergen, Karly C. Sourris, Brooke E. Harcourt, David R. Thorburn, Ian A. Trounce, Mark E. Cooper, Josephine M. Forbes
Journal:
Clinical Science
Clin Sci (Lond) (2016) 130 (9): 711–720.
Published: 18 March 2016
... by mitochondria, which are dynamic organelles, constantly fusing and dividing to maintain kidney homoeostasis. In diabetic kidney disease (DKD), mitochondria appear dysfunctional, but the temporal development of diabetes-induced adaptations in mitochondrial structure and bioenergetics have not been previously...
Articles
Mark R. Edwards, Pervez Sultan, Ana Gutierrez del Arroyo, John Whittle, Shamir N. Karmali, S. Ramani Moonesinghe, Fares S. Haddad, Michael G. Mythen, Mervyn Singer, Gareth L. Ackland
Journal:
Clinical Science
Clin Sci (Lond) (2015) 129 (5): 423–437.
Published: 11 June 2015
.... This hypometabolic phenotype triggered by glucocorticoid-induced mitochondrial dysfunction activating the NLRP1 inflammasome prevents normal lymphocyte functionality and increases apoptosis. apoptosis inflammasome lymphocyte metabolism mitochondria sepsis • The mechanism underlying...
Includes: Supplementary data
Articles
Yi Zhao, Ulf Lützen, Jürgen Fritsch, Maaz Zuhayra, Stefan Schütze, Ulrike M. Steckelings, Chiara Recanti, Pawel Namsoleck, Thomas Unger, Juraj Culman
Journal:
Clinical Science
Clin Sci (Lond) (2015) 128 (9): 567–578.
Published: 11 February 2015
...Yi Zhao; Ulf Lützen; Jürgen Fritsch; Maaz Zuhayra; Stefan Schütze; Ulrike M. Steckelings; Chiara Recanti; Pawel Namsoleck; Thomas Unger; Juraj Culman The presence of angiotensin type 2 (AT 2 ) receptors in mitochondria and their role in NO generation and cell aging were recently demonstrated...
Articles
Marie-Claude Denis, Yves Desjardins, Alexandra Furtos, Valérie Marcil, Stéphanie Dudonné, Alain Montoudis, Carole Garofalo, Edgard Delvin, André Marette, Emile Levy
Journal:
Clinical Science
Clin Sci (Lond) (2015) 128 (3): 197–212.
Published: 03 October 2014
... their innate function. Additionally, the influence of polyphenols on the interplay between mitochondria and OxS has not been thoroughly examined in the gut epithelium. Thus, in the present study, we have tested the hypothesis that polyphenols can attenuate OxS and inflammation in enterocytes. We investigated...
Includes: Supplementary data
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2014) 126 (2): 111–121.
Published: 13 September 2013
... between NADPH oxidase and mitochondria, the main ROS sources in hypertension, which may represent a vicious feed-forward cycle of ROS production. In recent years, there is experimental evidence showing a relationship between ROS and COX-derived products. Thus ROS can activate COX and the COX/PG...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2008) 114 (1): 27–35.
Published: 30 November 2007
... Biochemical Society 2008 apoptosis cell proliferation cell cycle energy metabolism magnesium transport mitochondria Mg (magnesium; referring to both bound and free forms) is referred to as the intracellular divalent cation par excellence . Its biological role is extremely versatile...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2006) 110 (2): 205–206.
Published: 17 January 2006
... mitochondria to generate reactive oxygen species in the vascular wall during mineralocorticoid-induced hypertension in the rat. These studies open a new line of investigation that could be important for the development of therapeutic strategies; however, there still remains a great deal of uncertainty about...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2005) 108 (3): 185–194.
Published: 18 February 2005
... identify novel targets for future diabetes therapies. Mitochondrial metabolism is crucial for the coupling of amino acid and glucose recognition to the exocytosis of the insulin granules. This is illustrated by in vitro and in vivo observations discussed in the present review. Mitochondria generate ATP...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (2001) 101 (5): 493–498.
Published: 25 September 2001
... and energy charge were less conclusive. These findings suggest that indomethacin affects mitochondria and thereby impairs energy metabolism in jejunal tissue. Correspondence: Dr R. J. Simpson, Department of Endocrinology, Diabetes and Internal Medicine, King's College Denmark Hill Campus, Bessemer Rd...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1998) 95 (3): 385–388.
Published: 01 September 1998
... form of the drug with protons in the intermembrane space of mitochondria to disrupt the potential across the inner mitochondrial membrane and thereby initiate apoptosis. Normal cells are not affected. Present address: P.O. Box 289, Silver City, NM 88062, U.S.A. 13 10 1997 20 1 1998...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1997) 92 (3): 225–235.
Published: 01 March 1997
... and nerve deafness. 6. Nuclear gene defects may result in mitochondrial disorders by predisposing to multiple mitochondrial DNA deletions or quantitative depletions of mitochondrial DNA content. © 1997 The Biochemical Society and the Medical Research Society 1997 diabetes genetics mitochondria...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1996) 91 (1): 51–58.
Published: 01 July 1996
... absorption properties of two key biochemical com- ponents, namely haemoglobin and myoglobin [2, 3, 81. The oxygenation status of haemoglobin and Key words: cardiac, cytochrome oo3, haemodynamics, ischaemia, mitochondria, spectrophotometry. Abbreviations: HbD. oxygenation index; HbO,, oxygenated haemoglobin...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1996) 90 (4): 295–300.
Published: 01 April 1996
... by reverse transcriptase-polymerase chain reaction techniques in relation to functional studies of muscle mitochondria and the muscle RNA/DNA ratio. 3. Fifty-eight percent of patients reported an uncharacterized ‘viral infection’ before the onset of their illness, but none of the muscle samples from 34...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1995) 89 (6): 581–590.
Published: 01 December 1995
... consequence of reduced blood flow, and may be related to change in muscle fibre type. 4 7 1995 1 9 1995 © 1995 The Biochemical Society and the Medical Research Society 1995 arterial disease ATP synthesis bioenergetics glycogenolysis mitochondria occlusive oxidative metabolism 31...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1994) 87 (5): 499–503.
Published: 01 November 1994
... and salicylate on ADP-induced O 2 consumption by mitochondria (State 3 rate) respiring on pyruvate, and oxidation of [1- 14 C]- and [2- 14 C]-pyruvate to 14 CO 2 . 2. The rate of State 3 respiration was inhibited and plateaued at 45% with 10 mmol/l NH 4 Cl. 3. Oxidation of [1- 14 C]pyruvate was not significantly...
Articles
Graham P. Butcher, Nigel Deighton, Roger M. Batt, Boliang Ding, Susan Haywood, John Hoffman, Malcolm J. Jackson, Martyn C. R. Symons, Jonathan M. Rhodes
Journal:
Clinical Science
Clin Sci (Lond) (1993) 84 (3): 339–348.
Published: 01 March 1993
... The Biochemical Society and the Medical Research Society 1993 alcohol free radical iron liver mitochondria peroxisome electron paramagnetic resonance spectroscopy subcellular fractionation Clinical Science (1993) 84, 339-348 (Printed in Great Britain) 339 Electron paramagnetic resonance...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1991) 81 (5): 645–653.
Published: 01 November 1991
...Peter Bárány; Rolf Wibom; Eric Hultman; Jonas Bergström 1. The ATP production rate in isolated skeletal muscle mitochondria was measured with a bioluminescence method, before and during erythropoietin treatment, in 21 anaemic haemodialysis patients. In addition, the concentrations of ATP...
Articles
Taisuke Morimoto, Akira Tanaka, Yoshiro Taki, Masashi Noguchi, Naoki Yokoo, Tomohiko Nishihira, Katsuhide Nishikawa, Shunji Yamamoto, Naoki Nitta, Akira Jikkoh, Yasuo Kamiyama, Yoshio Yamaoka, Kazue Ozawa
Journal:
Clinical Science
Clin Sci (Lond) (1988) 74 (5): 485–489.
Published: 01 May 1988
..., the cytochrome oxidase activity of mitochondria and the hepatic adenylate energy charge level ( in situ ) were studied in cirrhotic rat liver induced by carbon tetrachloride (CCl 4 ). 2. In the cirrhotic liver mitochondria, concentrations of cytochrome a (+ a 3 ), cytochrome b , coenzyme Q 9 and coenzyme Q 10...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1985) 69 (2): 153–163.
Published: 01 August 1985
... individuals. 2. The subsarcolemmal mitochondria were released by gentle homogenization, with a recovery of 32-37%, and the intermyofibrillar by enzymic digestion and further mechanical disintegration, recovery 18-21%. The subsarcolemmal mitochondria were morphologically defined as those located within 2 μm...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1984) 66 (2): 173–178.
Published: 01 February 1984
...K. Gohil; D. A. Jones; R. H. T. Edwards 1. Activities for the oxidation of palmitoyl-carnitine, of palmitoyl-CoA and of carnitine palmitoyltransferase were measured in mitochondria prepared from needle biopsy samples of human skeletal muscle. Results are presented for nine normal subjects and 18...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1980) 59 (6): 457–462.
Published: 01 December 1980
... a major peak (modal density, 1.17) with a small subsidiary peak (modal density 1.24). 3. The following organelles, characterized by their marker enzymes, were located in the density gradients; plasma membrane (5′-nucleotidase), mitochondria (malate dehydrogenase), peroxisomes (catalase), lysosomes (β- N...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1980) 59 (1): 7–12.
Published: 01 July 1980
... lysosomes mitochondria plasma membrane Pompe's disease subcellular fractionation © 1980 The Biochemical Society and the Medical Research Society 1980 6 11 1979 13 2 1980 Clinical Science (1 980) 59,7- 12 7 Subcellular fractionation studies on hepatic tissue from a patient...
Articles
Journal:
Clinical Science
Clin Sci (Lond) (1980) 59 (1): 1–6.
Published: 01 July 1980
... density 1.18) and a substantial shoulder extending into the denser regions of the gradient. 3. The following organelles, characterized by their marker enzymes, were located in the density gradients: plasma membrane (5′-nucleotidase), mitochondria (malate dehydrogenase), peroxisomes (catalase), lysosomes...
1
