Abstract
Background: Prostaglandin-E1 (PGE1) is a potent vasodilator with anti-inflammatory and antiplatelet effects. However, the mechanism by which PGE1 contributes to the amelioration of cardiac injury remains unclear.
Methods: The present study was designed to investigate how PGE1 protects against hypoxia/reoxygenation (H/R)-induced injuries by regulating microRNA-21-5p (miR-21-5p) and fas ligand (FASLG). Rat H9C2 cells and isolated primary cardiomyocytes were cultured under hypoxic conditions for 6 h (6H, hypoxia for 6 h), and reoxygenated for periods of 6 (6R, reoxygenation for 6 h), 12, and 24 h, respectively. Cells from the 6H/6R group were treated with various doses of PGE1; after which, their levels of viability and apoptosis were detected.
Results: The 6H/6R treatment regimen induced the maximum level of H9C2 cell apoptosis, which was accompanied by the highest levels of Bcl-2-associated X protein (Bax) and cleaved-caspase-3 expression and the lowest level of B-cell lymphoma 2 (Bcl-2) expression. Treatment with PGE1 significantly diminished the cell cytotoxicity and apoptosis induced by the 6H/6R regimen, and also decreased expression of IL-2, IL-6, P-p65, TNF-α, and cleaved-caspase-3. In addition, we proved that PGE1 up-regulated miR-21-5p expression in rat cardiomyocytes exposed to conditions that produce H/R injury. FASLG was a direct target of miR-21-5p, and PGE1 reduced the ability of H/R-injured rat cardiomyocytes to undergo apoptosis by affecting the miR-21-5p/FASLG axis. In addition, we proved that PGE1 could protect primary cardiomyocytes against H/R-induced injuries.
Conclusions: These results indicate that PGE1 exerts cardioprotective effects in H9C2 cells during H/R by regulating the miR-21-5p/FASLG axis.
Background
Hypoxia/reperfusion (H/R) is a significant cause of cellular injury and tissue damage in many pathophysiological processes, including ischemic syndromes, ischemia/reperfusion, and stroke [1,2]. Cell apoptosis can occur followed by reoxygenation, in which case, a downstream responder pathway might be needed to direct cells toward an organized apoptosis process [3]. H/R-induced injuries generate cytotoxic reactive oxygen species and are associated with exaggerated inflammatory responses and the recruitment of leukocytes to the sites of inflammation [4]. For many years, symptoms of myocardial dysfunction (e.g. arrhythmia and myocardial failure) have been viewed as the main problems associated with H/R-induced injuries to cardiac tissue [5], and they still remain a significant clinical problem; particularly after percutaneous coronary intervention (PCI). In recent years, a substantial effort has been made to develop methods of protecting against H/R-induced injuries to cardiac tissue.
Prostaglandin E (PGE1, alprostadial) is a naturally occurring substance found in various mammalian tissues [6]. Accumulating evidence suggests that PGE1 can help prevent the harmful effects of various cardiovascular diseases, as well as ischemia/reperfusion injuries [7]. Moreover, PGE1 is often used to treat peripheral occlusive vascular diseases [8]. Acciavatti et al. [9] suggested a favorable effect of intravenously administered PGE1 in treatment of patients with chronic vascular disease, as it helped to prevent increases in local tissue perfusion caused by vasodilators. Mehrabi et al. [10] confirmed that angiogenesis was stimulated in infract tissues surrounding the normal myocardium of patients administered PGE1, and that effect was due to modulation of VEGF. The PGE1-induced protection of mitochondria, prevention of damage due to oxidative stress, attenuation of microthrombi formation, and suppression of inflammation have all been demonstrated in a sodium laurate-induced rat model of coronary microembolization [11].
Moreover, PGE1 appears to prevent several types of human cells from undergoing apoptosis. For example, it increases the number of human bone-marrow endothelial progenitor cells by decreasing apoptosis though regulation of PI3-kinase [12]. PGE1 treatment was also reported to effectively suppress the apoptosis of human umbilical vein endothelial cells and increase cell viability under conditions of H2O2-induced oxidative stress [13]. Additionally, it was shown to prevent ischemia/reperfusion injuries by inducing the production of pro- and anti-inflammatory cytokines [14]. Although PGE1 can afford myocardial protection, few studies have examined how it functions in cardiomyocytes after H/R treatment. In the present study, an H/R rat model was constructed and used to investigate the effects of PGE1 on H/R-induced cardiocyte injuries.
MicroRNAs (miRNAs) comprise a class of small endogenous non-coding RNAs that contain 20–25 nucleotides, and regulate gene expression at the post-transcription level by binding to the 3′-untranslational region (3′-UTR) of their target mRNAs [15]. Numerous studies have shown that miRNAs play important roles in pathological processes by influencing cell proliferation, differentiation, apoptosis, migration, and invasion [16–20]. Abnormal miRNA expression can lead to myocardial reperfusion injuries [21–23]. Studies have indicated that miR-21-5p plays essential roles in acute drug-induced cardiac injuries [24] in hyperlipidemia rats [25] and high glucose-induced retinal microvascular endothelial cells [26]. Therefore, it is extremely important to study the mechanism and function of miR-21-5p in rat cardiomyocytes being exposed to conditions of H/R.
In our study, we explored the effects of PGE1 on cell viability, and the expression levels of apoptosis-related and inflammation-related proteins in rat cardiomyocytes under conditions of H/R. Furthermore, we examined how PGE1 influences miR-21-5p and FASLG expression, and the effects of PGE1 on the apoptosis of rat cardiomyocytes being exposed to conditions that produce H/R injuries. Our results identified a mechanism by which PGE1 ameliorates cardiac injuries caused by H/R.
Materials and methods
Cell culture and H/R injury induction
Rat H9C2 cells were provided by the American Type Culture Collection (ATCC, Manassas, VA, U.S.A.) and cultured in Dulbecco’s Modified Eagle Media (DMEM) supplemented with 10% fetal bovine serum (FBS, Invitrogen, Carlsbad, CA, U.S.A.) and 100 U/ml penicillin (Beyotime, China). After 6 days of cell culture, the original culture medium was replaced with 1% FBS-DMEM, and the cells were randomly divided into the following four groups: (1) Control group, in which cells were incubated under nontoxic conditions in a humidified 37°C incubator containing 5% CO2; (2) Hypoxia (H) group, in which the culture dishes were transferred into a hypoxic incubator (95% N2, 5% CO2) and incubated for 6 h; (3) Hypoxia/reoxygenation (H/R) group, in which the cells were exposed to 6 h of hypoxia followed by 6, 12, or 24 h of reoxygenation (95% air and 5% CO2). These three groups were designated as the 6H/6R, 6H/12R, and 6H/24R group, respectively. (4) PGE1 with 6H/6R group, in which after 6 h of hypoxia, the cells were treated with different concentrations of PGE1 (0.5, 1.0, and 2.0 μM) during hypoxia, and then exposed to 6 h of reoxygenation.
Rat cardiomyocytes were prepared from the hearts of 2- to- 3-day-old Sprague Dawley rats as previously described [27]. Aliquots of suspended cells were added to culture flasks and culture dishes, and cultured in a 5% CO2 incubator at 37°C for 2 h. The non-cardiomyocytes, which adhered to the walls faster, were the first to attach to the bottom of the culture vessels, while the cardiomyocytes remained suspended. In that state, the cell suspensions were inoculated into 50 ml culture flasks. The Sprague Dawley rats were purchased from the Animal Center of Central South University and conducted related experiments here. The study protocol was approved by the Ethics Committee of Central South University.
Cell viability assessment
Cell viability was assessed using a Cell-Counting Kit-8 (CCK-8, Dojindo, Japan) according to the manufacturer’s instructions. In brief, cells from the Control or PGE1 with 6H/6R group were plated into 96-well plates at a density of 3 × 103 cells per well. After the cells had been incubated for 24 h, 10 μl of the CCK-8 solution was added to each well, and the cells were incubated for an additional 2 h at 37°C. Next, the optical density of each well was measured at 450 nm with a microplate reader (Thermo Fisher Scientific, Waltham, MA, U.S.A.). The cell proliferation rate (%) was calculated as follows: proliferation rate (%) = A450 sample/A450 control × 100%.
Lactate dehydrogenase release (LDH) assay
The cell supernatants from the control group or 6H/6R group treated with different concentrations of PGE1 were collected for detection of their LDH levels. Briefly, cells were plated into 96-well plates at a density of 3 × 103 cells/well and cultured for 10 h; after which, the amount of LDH activity in each well was determined using an LDH assay kit (R&D Systems, Minneapolis, MN, U.S.A.) according to the manufacturer’s instructions. LDH activity was expressed as U/l.
Hoechst 33258 staining
Briefly, cells from the different treatment groups were seeded into 6-well plates and incubated overnight at 37°C. The cells were then fixed in 4% formaldehyde for 10 min, rinsed three times with PBS, and then incubated with 0.5 ml of blue nucleic acid counterstaining solution (Hoechst 33258, 2 μg/ml, Sigma-Aldrich, St. Louis, MO, U.S.A.) for 5 min at room temperature. Subsequently, the cells were observed with a fluorescence microscope (Leica, Germany).
Flow cytometry analysis
Cell apoptosis was detected by flow cytometry after Annexin V FITC/PI double staining. Briefly, the cells were washed two times with cold PBS and then resuspended in a binding buffer. The suspended cells were then stained with 5 μl of FITC Annexin VFITC and 10 μl of PI for 20 min in the dark at room temperature; after which, cell apoptosis was analyzed by flow cytometry (BD Biosciences, Franklin Lakes, NJ, U.S.A.).
RNA extraction and quantitative real-time PCR (qRT-PCR)
Total cellular RNA was extracted using TRIzol reagent (Takara, Japan), and then reverse transcribed to cDNA using a Bestar™ qPCR RT kit (DBI Bioscience, China). Amplification was performed on an ABI PRISM 7500 Sequence Detection System (Life Technologies, Carlsbad, CA, U.S.A.) with Bestar™ qPCR MasterMix (DBI Bioscience). The primers used in the study are shown in Table 1.
ID . | Sequence (5′- 3′) . |
---|---|
U6 F | CTCGCTTCGGCAGCACA |
U6 R | AACGCTTCACGAATTTGCGT |
miR-21 RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACAT |
miR-21 F | ACACTCCAGCTGGGTAGCTTATCAGACTGATG |
miR-21 R | CTCAACTGGTGTCGTGGA |
ID . | Sequence (5′- 3′) . |
---|---|
U6 F | CTCGCTTCGGCAGCACA |
U6 R | AACGCTTCACGAATTTGCGT |
miR-21 RT | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACAT |
miR-21 F | ACACTCCAGCTGGGTAGCTTATCAGACTGATG |
miR-21 R | CTCAACTGGTGTCGTGGA |
F: forward primer; R: reverse primer. RT: reverse transcription primer.
Western blotting
The treated cells in each group were washed twice with ice-cold PBS and then lysed in 0.5 ml of lysis buffer for 20 min at 4°C. Next, the lysates were centrifuged for 10 min at 12,000 g and 4°C, and the supernatants were collected. The protein concentration in each supernatant was determined using a BCA Protein assay kit (Thermo Fisher Scientific, Inc.). Next, an equal amount of protein from each supernatant was separated by 10% SDS-PAGE, and the protein bands were transferred onto polyvinylidene fluoride (PVDF) membranes, which were subsequently blocked with skim milk. The membranes were then incubated with primary antibodies against cleaved-caspase-3 (CST, Danvers, MA, U.S.A., 9654s), IL-2 (CST, D7A5), IL-6 (CST, D3K2N), P-p65 (CST, 93H1), p-65 (CST, D14E12), TNF-α (CST, 3707), FASLG (Abcam, Cambridge, MA, U.S.A., ab15285), and GAPDH (CST, 14C10) overnight at 4°C; After which, the membranes were incubated with horseradish peroxidase-conjugated anti-IgG (Santa Cruz Biotechnology, Dallas, TX, U.S.A.) as the secondary antibody. The immunostained protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Pierce, Rockford, IL, U.S.A.).
Dual-luciferase reporter assay
The binding site of miR-21-5p (including the FASLG-Wild and FASLG-Mut) was constructed and inserted into a psiCHECK-2 vector (Realgene, Nanjing, China). Briefly, H9C2 cells were seeded into 24-well plates and transfected with the corresponding reporter plasmids by using Lipofectamine 2000 (Invitrogen, Shanghai, China). After 48 h of transfection, the cells were collected and assayed with a Dual Luciferase Assay System (Promega, Madison, WI, U.S.A.) according to the manufacturer’s instructions.
Statistical analysis
All quantitative data were analyzed using PASW Statistics for Windows, Version 18.0 (SPSS Inc., Chicago, IL, U.S.A.), and results are expressed as the mean ± SD of data obtained from least three experiments. Comparisons between two groups were performed using Student’s t-test and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. Each experiment was performed at least three times. A P-value < 0.05 was considered to be statistically significant.
Results
Construction of the H/R injury cell model in rat cardiomyocytes
To assess the potential effects of PGE1 on H/R injuries, rat cardiomyocytes and H9C2 cells were exposed to conditions that produce H/R injury for different time periods (6, 12, and 24 h, respectively). As shown in Figure 1A, H9C2 cells in the control group displayed a normal shape with round intact nuclei. After 6 h of hypoxia, the numbers of cells were reduced, and the cells displayed smaller sized nuclei and moderately condensed chromatin. Hoechst staining revealed dramatic decreases in blebbing, as well as the presence of fluorescent spots and pyknotic nuclei in H/R damaged cells when compared with cells in the 6H/6R group. Those changes manifested within 24 h of reoxygenation, and occurred in a time-dependent manner. Protein expression assays showed that Bax and cleaved-caspase-3 levels were up-regulated, while Bcl-2 levels were remarkably down-regulated in the 6H group when compared with the control group, and those changes were even more remarkable in the 6 H group followed by 6 h of reoxygenation, indicating that the H/R injuries had induced an increase in cell apoptosis. However, as the reoxygenation time increased (12, 24 h), the levels of Bax and cleaved-caspase-3 expression in the 6 H group gradually declined, while Bcl-2 levels continued to increase (Figure 1B,C). Thus, 6 h of hypoxia followed by 6 h of reoxygenation was selected for constructing the H/R injury cell model.
Evaluation of apoptosis following myocardial cell H/R injury
PGE1 attenuated H/R-induced cell growth inhibition, cytotoxicity, and apoptosis in rat cardiomyocytes
To examine whether PGE1 protected cardiomyocytes against H/R injury, cells from the 6H/6R group were treated with various doses of PGE1 for 24 h; after which, their viability was measured. As shown in Figure 2A, the cell survival rate significantly decreased after 6 h of hypoxia followed by 6 h of reoxygenation, but obviously increased after PGE1 treatment in a dose-dependent manner (P < 0.05, P < 0.01). When the concentration of PGE1 reached 2.0 μM, cell viability was nearly the same as that in the control group. LDH activity was used as an indicator of cytotoxicity. Measurements of LDH activity in the cell supernatants showed that addition of PGE1 could prevent the H/R-induced release of LDH in dose-dependent manner (Figure 2B, P < 0.05, P < 0.01, and P < 0.001). A plot of Annexin V versus PI staining from the gated cells was constructed to show the relative populations of early apoptotic (Annexin V+/PI-) and late apoptotic (Annexin V+/PI+) cells (Figure 2C). A statistical analysis showed that a higher concentration of PGE1 significantly diminished H9C2 cell apoptosis in the 6H/6R group (Figure 2D, P < 0.05, P < 0.01, P < 0.001). These results suggested that PGE1 could partially protect cardiomyocytes against H/R injury.
Protective effect of PGE1 against H/R-induced cardiomyocyte injury
PGE1 regulated factors associated with inflammation and apoptosis during H/R injury
The above results indicated that 2.0 μM PGE1 could significantly reduce cardiomyocyte apoptosis caused by H/R injury. Next, Hoechst 33258 staining (blue) confirmed that 2.0 μM PGE1 obviously decreased nuclear pyknosis, chromosome fragmentation, chromatin condensation, and the formation of apoptosis bodies in the 6H/6R group (Figure 3A). To gain a better understanding of the molecular mechanism by which PGE1 alleviated myocardial H/R injuries, Western blotting was used to detect the expression levels of molecules associated with inflammation and apoptosis in H9C2 cells from the different groups (control, 6H/6R, and 6H/6R+2.0 μM PGE1). As shown in Figure 3B, the levels of cell inflammation factors IL-2, IL-6, P-p65, and TNF-α in H9C2 cells were obviously elevated after 6 h of hypoxia followed by 6 h of reoxygenation, but were significantly reduced following addition of 2.0 μM PGE1. In addition, the pro-apoptotic molecule cleaved-caspase-3 displayed similar trends in H9C2 cells from the above three groups. A statistical analysis of IL-2, IL6, P-p65, and TNF-α expression is shown in Supplementary Figure S1.
PGE1 regulated factors associated with inflammation and apoptosis during H/R injury
PGE1 up-regulated miR-21-5p expression and down-regulated FASLG expression in rat cardiomyocytes under conditions of H/R injury
To further explore the mechanism by which PGE1 protects rat cardiomyocytes against H/R injury, myocardial H9C2 cells undergoing H/R injury were incubated with different concentrations of PGE1. We found that miR-21-5p expression was decreased in the H/R model group when compared with its expression in the control group. Furthermore, as the concentration of PGE1 increased, miR-21-5p expression in the PGE1 group gradually increased when compared with its expression in the H/R model group (P < 0.01, P < 0.001, Figure 4A). We also found that FASLG protein expression was increased in the H/R model group when compared with its expression in the control group, but showed a decrease in the PGE1 group when compared with the H/R model group as the PGE1 concentration increased (Figure 4B). TargetScan (http://www.targetscan.org) was used to predict a binding site for miR-21-5p in human, chimp, and rabbit, FASLG mRNA, respectively (Figure 4C). To validate the interaction between miR-21-5p and FASLG mRNA, a fragment of FASLG mRMA that included the predicted target site or mutant target site was inserted downstream of the firefly luciferase gene designated as either Wild-FASLG or Mut-FASLG. Next, myocardial H9C2 cells were co-transfected with the FASLG vector and miR-21-5p mimics. The results showed that miR-21-5p could decrease luciferase expression in the Wild-FASLG when compared with the negative control (NC). However, there was no change in the luciferase activity of Mut-FASLG (P < 0.05, Figure 4D). These results suggested that miR-21-5p directly targets FASLG.
PGE1 up-regulated miR-21-5p expression and down-regulated FASLG expression in rat cardiomyocytes undergoing H/R injury
MiR-21-5p promoted apoptosis inhibited by PGE1 in rat cardiomyocytes undergoing H/R injury
Myocardial H9C2 cells undergoing H/R injury were treated with 2.0 μM PGE1, and then transfected with miR-21-5p mimics. A flow cytometry analysis indicated that the percentage of apoptotic cells was increased in the model group relative to that in the control group, and was significantly higher in the miR-21-5p+PGE1 group when compared with the PGE1 group. This indicated that PGE1 inhibited the apoptosis of rat cardiomyocytes by up-regulating miR-21-5p expression (P < 0.05, Figure 5A,B). Moreover, we found that PGE1 inhibited FASLG expression via miR-21-5p (Figure 5C). Finally, an experiment in which only miR-21-5p mimics and the inhibitor were added to the cells showed that PGE1 inhibited the apoptosis of rat cardiomyocytes by upregulating miR-21-5p expression (Figure 5D,F).
MiR-21-5p promoted apoptosis inhibited by PGE1 in rat cardiomyocytes under conditions of H/R injury
PGE1 helped to protect primary cardiomyocytes against H/R injury
Primary cardiomyocytes were isolated and exposed to H/R injury for 6, 12, and 24 h, respectively. We then examined how PGE1 functioned in primary cardiomyocytes receiving H/R injuries. Western blot results showed that Bax and cleaved-caspase-3 expressions were markedly up-regulated, while the levels of Bcl-2 was dramatically down-regulated in the treatment group versus control group, and especially 6H/6R treatment group, in addition, those changes in protein expressions gradually declined as the time of reoxygenation increased from 6 to 24 h (Figure 6A). Similarly, the activity of cleaved-caspase-3 and Bax/Bcl-2 ratio were significantly increased in the H/R treatment group when compared with its activity in the control group, and its activity was highest in the 6H/6R treatment group (Figure 6B). In addition, we found that cell viability was significantly decreased in the 6H/6R group relative to that in the control group, while treatment with PGE1 increased the viability of H/R-induced primary cardiomyocytes (Figure 6C). Moreover, LDH levels were significantly increased in the 6H/6R group when compared with those in the control group, while PGE1 decreased the LDH levels in H/R-induced primary cardiomyocytes in a dose-dependent manner (Figure 6D).
PGE1 protected primary cardiomyocytes against H/R-induced injuries
MiR-21-5p suppressed apoptosis induced by FASLG in rat cardiomyocytes after H/R injury
To further explore whether the inhibitory effect of miR-21-5p on apoptosis involved FASLG, H/R-induced rat cardiomyocytes and H9C2 cells were co-transfected with miR-21-5p mimics and the FASLG overexpression vector. The subsequent results revealed that there was a lower apoptosis rate in the 6H/6R+miR-21-5p group than in the 6H/6R group, while overexpression of FASLG could reverse the inhibition of cell apoptosis mediated by miR-21-5p in H/R-induced rat cardiomyocytes and H9C2 cells (P < 0.01, Figure 7A,B,D and E). Western blot assays showed that miR-21-5p down-regulated FASLG expression, which could be up-regulated by FASLG overexpression in H/R-induced rat cardiomyocytes (Figure 7C,F). We performed the same experiment using primary cardiomyocytes and obtained similar results.
MiR-21-5p suppressed apoptosis induced by FASLG in rat cardiomyocytes and H9C2 cells after H/R injury
Discussion
Prostaglandins are involved in immune regulation via various receptors [28–30]. PGE1 has been reported to produce clinical remission in patients with H/R-induced cellular injuries and organ damage [31,32]. PGE1 is a prostanoid synthesized from linoleic acid, can bind to multiple receptors, including the DP, IP, TP, FP, EP1, EP2, EP3, and EP4 receptors [33,34]. While the existing research on EP4 is relatively mature, studies have suggested that binding of EP4 produces significant effects in cases of renal ischemia-reperfusion (I/R) injury [35], myocardial I/R injury [36,37], and ischemic liver disease [38]. However, the mechanism by which PGE1 protects against myocardial cell injuries caused by H/R remains unclear. Our current studies produced the following novel findings: (i) PGE1 helps to protect against H/R-induced impairment of cell viability as well as cytotoxicity, and abnormal apoptosis; (ii) the down-regulation of H/R-induced inflammatory factors (IL-2, IL-6, P-p65, and TNF-α) is associated with the anti-inflammatory effect of PGE1; (iii) inactivation of cleaved-caspase-3 contributes to the anti-apoptotic effect of PGE1.
Increasing numbers of studies have demonstrated that PGE1 plays an important role in determining the survival of cells exposed to H/R conditions. PGE1 treatment of liver sinusoidal endothelial cells increases their survival and resistance to apoptosis during H/R injury by suppressing NO production and MMP release [31]. Interestingly, a previous study by Ma et al. [32] reported that the total number of cardiomyocytes was decreased in an H/R group when compared with a group of cardiomyocytes pretreated with PGE1, and the mechanism for that effect probably involved a decrease in Bax expression and an increase in Bcl-2 expression. Caspase 3, which is downstream of Bcl-2 and Bax, is considered to be a critical protease required for apoptosis [39]. In the present study, we observed that inhibition of apoptosis by PGE1 in H/R injured cells involved the inactivation of cleaved-caspase-3. Our results support a model in which PGE1 inhibits apoptosis in cardiomyocytes, at least in part, via a cleaved-caspase-3 dependent pathway. We speculate that inhibition of cleaved-caspase-3 during H/R increases cell viability by suppression of apoptosis, as described by Kang et al. [40]. Human and experimental studies have implicated cardiomyocyte apoptosis in the pathogenesis and development of various cardiac diseases, including myocardial infarction, ischemia, and heart failure [41,42]. Previous findings from in vitro studies have shown that apoptotic cell death is triggered by an IL-2-dependent activation of the Fas-FasL pathway [43]. IL-6 was shown to activate the apoptosis-associated factors Caspase3 and Smad3, and decrease expression of the anti-apoptotic factor Bcl2, resulting in the apoptosis of cardiomyocytes cultured under hypoxic conditions [44]. It was reported that a reduction of p-P65 expression attenuated the apoptosis of H9c2 rat cardiomyocytes, while TNF-α caused a significant increase in the expression of apoptotic proteins Bax, and Caspase 3, which directly correlated with subsequent apoptosis [45,46]. Consistent with these findings, our data showed that PGE1 significantly diminished apoptosis, and decreased the expression of IL-2, IL-6, P-p65, and TNF-α. Therefore, the results our investigations can be helpful in guiding the clinical use of PGE1.
We assessed cell injury by evaluating the release of LDH, an indicator of cytotoxicity that also reflects the inflammation level. Our results showed that PGE1 inhibited H/R-induced production of LDH in a dose-dependent manner. PGE1 has been identified as a possible mediator of inflammation [14]. For example, PGE1 was shown to attenuate the secretion of pro-inflammatory cytokines IL-6 and IL-8 during cardiac surgery, and thus help alleviate ischemia/reperfusion injuries [14]. Gezginci-Oktayoglu et al. [47] showed that PGE1 exerts an anti-inflammatory effect that ameliorates renal ischemia/reperfusion injury-induced gastric damage by decreasing the production of pro-inflammatory cytokines TNF-α and IL-1β. In this study, PGE1 treatment prevented the generation of pro-inflammatory cytokines (IL-2, IL-6, and TNF-α), and attenuated the expression of p-p65 (phosphorylated NF-κB p65 subunit). A previous study demonstrated that activation of the NF-κB signaling pathway promoted the transactivation of multiple inflammatory cytokines, including IL-2, IL-6, IL-12, and IL-18. Our results suggest that PGE1 protects against inflammation by preventing the release of pro-inflammatory cytokines (IL-2, IL-6, and TNF-α) triggered by inflammatory responses in cardiomyocytes. Furthermore, that effect appears to be mainly related to inactivation of the NF-κB signaling pathway. It is likely that the inhibition of inflammatory cytokine production induced by PGE1 is the major cause of the decrease in LDH production, and that the resultant corresponding decrease in cytotoxicity contributes to an increase in cell viability.
A previous study showed that miR-21-5p relieves leakage from damaged brain microvascular endothelial barrier by inhibiting inflammation and apoptosis [48]. MiR-21-5p is a potential biomarker of cardiac inflammatory infiltration during acute drug-induced cardiac injuries [24], and is up-regulated in type 1 diabetes by the action of inflammatory cytokines [49]. In our study, we found that PGE1 up-regulated miR-21-5p expression in rat cardiomyocytes under conditions of H/R injury, and inhibited the apoptosis ability of rat cardiomyocytes by up-regulating miR-21-5p.
Furthermore, we used the prediction algorithms of TargetScan, miRDB, and microrna.org to predict a binding site for miR-21-5p on FASLG mRNA and found that miR-21-5p directly targeted FASLG. FASLG is a type-II membrane protein that binds to and activates Fas-receptors, leading to cell apoptosis [50]. Multiple studies have proved that miR-21 promotes cell proliferation by targeting FASLG [51–53]. In our study, we proved that PGE1 down-regulates FASLG expression by increasing miR-21-5p expression in rat cardiomyocytes exposed to conditions that produce H/R injury.
Conclusion
In conclusion, PGE1 treatment helps to protect cardiomyocytes from H/R injuries. The mechanism for this effect is complicated, and involves the down-regulation of cleaved-caspase-3 and inflammatory factors (IL-2, IL-6, TNF-α, and P-p65). PGE1 inhibited the apoptosis ability of rat cardiomyocytes via mediation of the miR-21-5p/ FASLG axis. The results of the present study increase our understanding of the use of PGE1 in various cardiovascular diseases.
Author Contribution
(I)Conception and design: M Tang, Y Zhou; (II) Administrative support: Y Zhou, H Pan; (III) Provision of study materials or patients: M Tan, Z Zheng, Y Guo; (IV) Collection and assembly of data: J Peng, J Yang, Y Luo; (V) Data analysis and interpretation: J He, S Yan, P Wang, Y Zhang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.
Competing Interests
The authors declare that there are no competing interests associated with the manuscript.
Funding
This study was supported by the Hunan Provincial People’s Hospital RenShu Fund [grant number 2008-16].